Laboratory Procedures and Important Historical Experiments - Genetics

Card 1 of 60

0
Didn't Know
Knew It
0
1 of 2019 left
Question

In order to amplify the following DNA sequence using PCR, what is an acceptable pair of oligonucleotide primers? (only the sense strand is shown)

ATGATCAGGCTAAATGCTAGTTTACCGGATGAGCAATGACGCGTACCATATAGGCATATCCGATGCCATGATGGCCTACGGATCA

Tap to reveal answer

Answer

There are two primary factors that influence the quality of a polymerase chain reaction (PCR) primer. The first is length. The primer should ideally be roughly 18-30 bases in length; this qualification can be used to rule out two of the possible given answer options. The second factor is the melting point of the primer. An ideal oligonucleutide sequence will have a relatively high cytosine/guanine content. These particular bases form three hydrogen bonds in the DNA molecule, while adenine and thymine form only two. Cytosine and guanine interactions thus require more energy to break, and raise hte melting point of the sample. The process of PCR requires heating the sample at certain points, which can become a problem for primers with high adenine/thymine content.

Our ideal answer will be a longer sequence (18 bases) with a high percentage of cytosine and guanine residues.

← Didn't Know|Knew It →