Laboratory Procedures and Important Historical Experiments - Genetics
Card 0 of 60
In order to amplify the following DNA sequence using PCR, what is an acceptable pair of oligonucleotide primers? (only the sense strand is shown)
ATGATCAGGCTAAATGCTAGTTTACCGGATGAGCAATGACGCGTACCATATAGGCATATCCGATGCCATGATGGCCTACGGATCA
In order to amplify the following DNA sequence using PCR, what is an acceptable pair of oligonucleotide primers? (only the sense strand is shown)
ATGATCAGGCTAAATGCTAGTTTACCGGATGAGCAATGACGCGTACCATATAGGCATATCCGATGCCATGATGGCCTACGGATCA
There are two primary factors that influence the quality of a polymerase chain reaction (PCR) primer. The first is length. The primer should ideally be roughly 18-30 bases in length; this qualification can be used to rule out two of the possible given answer options. The second factor is the melting point of the primer. An ideal oligonucleutide sequence will have a relatively high cytosine/guanine content. These particular bases form three hydrogen bonds in the DNA molecule, while adenine and thymine form only two. Cytosine and guanine interactions thus require more energy to break, and raise hte melting point of the sample. The process of PCR requires heating the sample at certain points, which can become a problem for primers with high adenine/thymine content.
Our ideal answer will be a longer sequence (18 bases) with a high percentage of cytosine and guanine residues.
There are two primary factors that influence the quality of a polymerase chain reaction (PCR) primer. The first is length. The primer should ideally be roughly 18-30 bases in length; this qualification can be used to rule out two of the possible given answer options. The second factor is the melting point of the primer. An ideal oligonucleutide sequence will have a relatively high cytosine/guanine content. These particular bases form three hydrogen bonds in the DNA molecule, while adenine and thymine form only two. Cytosine and guanine interactions thus require more energy to break, and raise hte melting point of the sample. The process of PCR requires heating the sample at certain points, which can become a problem for primers with high adenine/thymine content.
Our ideal answer will be a longer sequence (18 bases) with a high percentage of cytosine and guanine residues.
Compare your answer with the correct one above
Chose the correct answer:
American geneticist Thomas Hunt Morgan is best known for .
Chose the correct answer:
American geneticist Thomas Hunt Morgan is best known for .
In 1910, Thomas Hunt Morgan performed a test cross between white-eyed male Drosophila and homozygous red-eyed females to test the frequency of white eyes in the subsequent generations. The F1 generation all had red eyes, but when Morgan crossed the F1 generation, he noticed a 3:1 ratio of red to white eyes in the F2 generation. In all of his experimements, the white-eyed F2 flies were always male. Subsequent experiments supported the hypothesis that the white-eye trait was sex-linked (in this case, to the X chromosome).
In 1910, Thomas Hunt Morgan performed a test cross between white-eyed male Drosophila and homozygous red-eyed females to test the frequency of white eyes in the subsequent generations. The F1 generation all had red eyes, but when Morgan crossed the F1 generation, he noticed a 3:1 ratio of red to white eyes in the F2 generation. In all of his experimements, the white-eyed F2 flies were always male. Subsequent experiments supported the hypothesis that the white-eye trait was sex-linked (in this case, to the X chromosome).
Compare your answer with the correct one above
Choose the correct answer:
In 1928, microbiologist Frederick Griffith demonstrated that bacteria can take up foreign DNA from the environment by a process known as .
Choose the correct answer:
In 1928, microbiologist Frederick Griffith demonstrated that bacteria can take up foreign DNA from the environment by a process known as .
This process is known as transformation. It was discovered after Griffith heat treated bacteria (to destroy their virulence) and noticed that mice injected with the heat-killed bacteria and a living, non-virulent strain would die of infection.
This process is known as transformation. It was discovered after Griffith heat treated bacteria (to destroy their virulence) and noticed that mice injected with the heat-killed bacteria and a living, non-virulent strain would die of infection.
Compare your answer with the correct one above
Choose the correct answer:
The idea that protein could be hereditary material was proved false in 1952 by which two scientists?
Choose the correct answer:
The idea that protein could be hereditary material was proved false in 1952 by which two scientists?
Hershey and Chase used radioisotopes to trace the DNA of a T2 phage (a virus that infects E. coli). Proteins contain sulfur; DNA does not. DNA contains phosphate; proteins do not. Using radioactive forms of sulfur and phosphate, they were able to selectively incorporate these isotopes into either the DNA or protein of a T2 phage and then physically separated the infected and uninfected bacteria. They found that the sulfur was not incorporated, while a portion of the phosphate entered the cells and could be recovered in the next generation. From these results, they were able to conclude that protein was not a hereditary material.
Hershey and Chase used radioisotopes to trace the DNA of a T2 phage (a virus that infects E. coli). Proteins contain sulfur; DNA does not. DNA contains phosphate; proteins do not. Using radioactive forms of sulfur and phosphate, they were able to selectively incorporate these isotopes into either the DNA or protein of a T2 phage and then physically separated the infected and uninfected bacteria. They found that the sulfur was not incorporated, while a portion of the phosphate entered the cells and could be recovered in the next generation. From these results, they were able to conclude that protein was not a hereditary material.
Compare your answer with the correct one above
Choose the correct answer:
Nucleic acid (at the time referred to as "nuclein") was first discovered by whom in 1869?
Choose the correct answer:
Nucleic acid (at the time referred to as "nuclein") was first discovered by whom in 1869?
Miescher, a Swiss chemist, first identified "nuclein" in the nuclei of white blood cells. He noted that the substance contained higher levels of phosphorus than other proteins and was resistant to proteolysis. This discovery was not widely appreciated for over 50 years.
Miescher, a Swiss chemist, first identified "nuclein" in the nuclei of white blood cells. He noted that the substance contained higher levels of phosphorus than other proteins and was resistant to proteolysis. This discovery was not widely appreciated for over 50 years.
Compare your answer with the correct one above
Choose the correct answer:
Russian biochemist Phoebus Levene is credited with being the first to .
Choose the correct answer:
Russian biochemist Phoebus Levene is credited with being the first to .
Levene accomplished all of these. He published more than 700 papers during his career. He used hydrolysis to break down and analyze yeast nucleic acids, proposing the composition of nucleic acids (phosphate, sugar, base) in 1919.
Levene accomplished all of these. He published more than 700 papers during his career. He used hydrolysis to break down and analyze yeast nucleic acids, proposing the composition of nucleic acids (phosphate, sugar, base) in 1919.
Compare your answer with the correct one above
Choose the correct answer:
Which of the following is a technique used to measure expression levels of large numbers of genes at the same time by taking advantage of hybridization between two DNA strands?
Choose the correct answer:
Which of the following is a technique used to measure expression levels of large numbers of genes at the same time by taking advantage of hybridization between two DNA strands?
DNA microarray allows investigators to analyze gene expression on a large scale. A Northern blot only permits analysis of the expression of one (or several) genes at a time. PCR is a method of amplifying DNA and a Western blot allows for analysis of proteins.
DNA microarray allows investigators to analyze gene expression on a large scale. A Northern blot only permits analysis of the expression of one (or several) genes at a time. PCR is a method of amplifying DNA and a Western blot allows for analysis of proteins.
Compare your answer with the correct one above
Choose the correct answer:
In the mid-1950s, there were three proposed models for DNA replication: semiconservative, conservative, and dispersive. Which of the following best describes the dispersive replication model?
Choose the correct answer:
In the mid-1950s, there were three proposed models for DNA replication: semiconservative, conservative, and dispersive. Which of the following best describes the dispersive replication model?
The dispersive model (now recognized to be incorrect), proposed that every occurrence of DNA replication would create DNA hybrids (from fragments of the the original double helix) that are one part original and one part new DNA. Each additional round would produce double helices with greater and greater quantities of DNA.
The dispersive model (now recognized to be incorrect), proposed that every occurrence of DNA replication would create DNA hybrids (from fragments of the the original double helix) that are one part original and one part new DNA. Each additional round would produce double helices with greater and greater quantities of DNA.
Compare your answer with the correct one above
Frederick Griffith’s 1928 experiment involved two different strains of Pneumococcus bacteria. What method of DNA transfer did the experiment demonstrate?
Frederick Griffith’s 1928 experiment involved two different strains of Pneumococcus bacteria. What method of DNA transfer did the experiment demonstrate?
One strain of Pneumococcus was called smooth due to a protective capsule, and the other strain that lacked the capsule was called rough. Mice that were injected with the smooth strain died, and mice injected with the rough strain lived because their immune system killed the bacteria. Griffith also killed some of the smooth strain and found that when mice were injected with the dead smooth strain lived, but mice injected with both live rough strain and dead smooth strain died. He determined that the living smooth strain cells were being transformed by some material from the dead smooth strain. Later experiments proved this material to be DNA.
One strain of Pneumococcus was called smooth due to a protective capsule, and the other strain that lacked the capsule was called rough. Mice that were injected with the smooth strain died, and mice injected with the rough strain lived because their immune system killed the bacteria. Griffith also killed some of the smooth strain and found that when mice were injected with the dead smooth strain lived, but mice injected with both live rough strain and dead smooth strain died. He determined that the living smooth strain cells were being transformed by some material from the dead smooth strain. Later experiments proved this material to be DNA.
Compare your answer with the correct one above
What is the name of the laboratory procedure by which a small amount of DNA can be made into many more copies through the use of DNA polymerases and heat cycling?
What is the name of the laboratory procedure by which a small amount of DNA can be made into many more copies through the use of DNA polymerases and heat cycling?
Polymerase chain reaction (PCR) is a method by which a specific sequence of DNA can be copied and replicated many times over in a test tube, which has been of enormous importance to the field of molecular biology. The other techniques listed all are important in molecular biology as well, but are typically for detection or other manipulations, not replication.
Polymerase chain reaction (PCR) is a method by which a specific sequence of DNA can be copied and replicated many times over in a test tube, which has been of enormous importance to the field of molecular biology. The other techniques listed all are important in molecular biology as well, but are typically for detection or other manipulations, not replication.
Compare your answer with the correct one above
What is the name of the method that allowed Watson and Crick to propose the double-helix structure of DNA?
What is the name of the method that allowed Watson and Crick to propose the double-helix structure of DNA?
Watson and Crick crystallized DNA to be able to visualize the structure, and it was this finding that led them to propose the double helix. Fun fact: Rosalind Franklin's work was essential to this finding as she was the expert in x-ray crystallography, but Watson and Crick are traditionally given all the credit.
Watson and Crick crystallized DNA to be able to visualize the structure, and it was this finding that led them to propose the double helix. Fun fact: Rosalind Franklin's work was essential to this finding as she was the expert in x-ray crystallography, but Watson and Crick are traditionally given all the credit.
Compare your answer with the correct one above
Which of the following scientists first discovered the concepts behind dominance, segregation, and independent assortment?
Which of the following scientists first discovered the concepts behind dominance, segregation, and independent assortment?
It was Gregor Mendel who did studies on pea plants to first described the concepts behind genetic inheritance. By breeding pea plants with different visible phenotypes and observing the phenotypes of the offspring produced, he was the first scientist to provide rules for heredity (now known as Mendelian inheritance).
It was Gregor Mendel who did studies on pea plants to first described the concepts behind genetic inheritance. By breeding pea plants with different visible phenotypes and observing the phenotypes of the offspring produced, he was the first scientist to provide rules for heredity (now known as Mendelian inheritance).
Compare your answer with the correct one above
Which of the following can be used to separate fragments resulting from transcription of double-stranded DNA?
Which of the following can be used to separate fragments resulting from transcription of double-stranded DNA?
The question is asking about separating mRNA fragments, not DNA fragments. Hence, the only procedure applicable is Northern blot. Southern blot is used for DNA, and Western blot is used for protein. In addition, there is no such thing as an Eastern blot.
The question is asking about separating mRNA fragments, not DNA fragments. Hence, the only procedure applicable is Northern blot. Southern blot is used for DNA, and Western blot is used for protein. In addition, there is no such thing as an Eastern blot.
Compare your answer with the correct one above
The experiment performed by Hershey and Chase demonstrated which important concept?
The experiment performed by Hershey and Chase demonstrated which important concept?
The experiment performed by Hershey and Chase showed that bacteriophages insert their DNA into bacteria, and not their protein. This demonstrated that DNA is the genetic material, and not proteins. Law of independent assortment and segregation are both Mendelian concepts.
The experiment performed by Hershey and Chase showed that bacteriophages insert their DNA into bacteria, and not their protein. This demonstrated that DNA is the genetic material, and not proteins. Law of independent assortment and segregation are both Mendelian concepts.
Compare your answer with the correct one above
Which of the following individuals is typically considered the "father of genetics" for his important discovers about the rules of genetic inheritance using pea plants?
Which of the following individuals is typically considered the "father of genetics" for his important discovers about the rules of genetic inheritance using pea plants?
Gregor Mendel was a German friar who lived in the mid- to late-nineteenth century. He conducted a years-long series of experiments using pea plants in which he carefully tracked each plant's physical traits and determined how cross-fertilization (breeding the pea plant to another pea plant, rather than to itself) affected the plants' offspring. Seed color, flower shape, height, and pod shape were among the traits he studied. In the end, he summarized his work into three laws of heredity: the laws of segregation, independent assortment, and dominance. He also coined the terms "recessive" and "dominant," in reference to genetic traits.
Unfortunately, Mendel's work remained largely unacknowledged through his life. The importance of his studies was only recognized by other scientists decades after his death.
Gregor Mendel was a German friar who lived in the mid- to late-nineteenth century. He conducted a years-long series of experiments using pea plants in which he carefully tracked each plant's physical traits and determined how cross-fertilization (breeding the pea plant to another pea plant, rather than to itself) affected the plants' offspring. Seed color, flower shape, height, and pod shape were among the traits he studied. In the end, he summarized his work into three laws of heredity: the laws of segregation, independent assortment, and dominance. He also coined the terms "recessive" and "dominant," in reference to genetic traits.
Unfortunately, Mendel's work remained largely unacknowledged through his life. The importance of his studies was only recognized by other scientists decades after his death.
Compare your answer with the correct one above
Choose the correct answer:
Which of the following is a technique used to measure expression levels of large numbers of genes at the same time by taking advantage of hybridization between two DNA strands?
Choose the correct answer:
Which of the following is a technique used to measure expression levels of large numbers of genes at the same time by taking advantage of hybridization between two DNA strands?
DNA microarray allows investigators to analyze gene expression on a large scale. A Northern blot only permits analysis of the expression of one (or several) genes at a time. PCR is a method of amplifying DNA and a Western blot allows for analysis of proteins.
DNA microarray allows investigators to analyze gene expression on a large scale. A Northern blot only permits analysis of the expression of one (or several) genes at a time. PCR is a method of amplifying DNA and a Western blot allows for analysis of proteins.
Compare your answer with the correct one above
Choose the correct answer:
Russian biochemist Phoebus Levene is credited with being the first to .
Choose the correct answer:
Russian biochemist Phoebus Levene is credited with being the first to .
Levene accomplished all of these. He published more than 700 papers during his career. He used hydrolysis to break down and analyze yeast nucleic acids, proposing the composition of nucleic acids (phosphate, sugar, base) in 1919.
Levene accomplished all of these. He published more than 700 papers during his career. He used hydrolysis to break down and analyze yeast nucleic acids, proposing the composition of nucleic acids (phosphate, sugar, base) in 1919.
Compare your answer with the correct one above
In order to amplify the following DNA sequence using PCR, what is an acceptable pair of oligonucleotide primers? (only the sense strand is shown)
ATGATCAGGCTAAATGCTAGTTTACCGGATGAGCAATGACGCGTACCATATAGGCATATCCGATGCCATGATGGCCTACGGATCA
In order to amplify the following DNA sequence using PCR, what is an acceptable pair of oligonucleotide primers? (only the sense strand is shown)
ATGATCAGGCTAAATGCTAGTTTACCGGATGAGCAATGACGCGTACCATATAGGCATATCCGATGCCATGATGGCCTACGGATCA
There are two primary factors that influence the quality of a polymerase chain reaction (PCR) primer. The first is length. The primer should ideally be roughly 18-30 bases in length; this qualification can be used to rule out two of the possible given answer options. The second factor is the melting point of the primer. An ideal oligonucleutide sequence will have a relatively high cytosine/guanine content. These particular bases form three hydrogen bonds in the DNA molecule, while adenine and thymine form only two. Cytosine and guanine interactions thus require more energy to break, and raise hte melting point of the sample. The process of PCR requires heating the sample at certain points, which can become a problem for primers with high adenine/thymine content.
Our ideal answer will be a longer sequence (18 bases) with a high percentage of cytosine and guanine residues.
There are two primary factors that influence the quality of a polymerase chain reaction (PCR) primer. The first is length. The primer should ideally be roughly 18-30 bases in length; this qualification can be used to rule out two of the possible given answer options. The second factor is the melting point of the primer. An ideal oligonucleutide sequence will have a relatively high cytosine/guanine content. These particular bases form three hydrogen bonds in the DNA molecule, while adenine and thymine form only two. Cytosine and guanine interactions thus require more energy to break, and raise hte melting point of the sample. The process of PCR requires heating the sample at certain points, which can become a problem for primers with high adenine/thymine content.
Our ideal answer will be a longer sequence (18 bases) with a high percentage of cytosine and guanine residues.
Compare your answer with the correct one above
Chose the correct answer:
American geneticist Thomas Hunt Morgan is best known for .
Chose the correct answer:
American geneticist Thomas Hunt Morgan is best known for .
In 1910, Thomas Hunt Morgan performed a test cross between white-eyed male Drosophila and homozygous red-eyed females to test the frequency of white eyes in the subsequent generations. The F1 generation all had red eyes, but when Morgan crossed the F1 generation, he noticed a 3:1 ratio of red to white eyes in the F2 generation. In all of his experimements, the white-eyed F2 flies were always male. Subsequent experiments supported the hypothesis that the white-eye trait was sex-linked (in this case, to the X chromosome).
In 1910, Thomas Hunt Morgan performed a test cross between white-eyed male Drosophila and homozygous red-eyed females to test the frequency of white eyes in the subsequent generations. The F1 generation all had red eyes, but when Morgan crossed the F1 generation, he noticed a 3:1 ratio of red to white eyes in the F2 generation. In all of his experimements, the white-eyed F2 flies were always male. Subsequent experiments supported the hypothesis that the white-eye trait was sex-linked (in this case, to the X chromosome).
Compare your answer with the correct one above
Choose the correct answer:
In 1928, microbiologist Frederick Griffith demonstrated that bacteria can take up foreign DNA from the environment by a process known as .
Choose the correct answer:
In 1928, microbiologist Frederick Griffith demonstrated that bacteria can take up foreign DNA from the environment by a process known as .
This process is known as transformation. It was discovered after Griffith heat treated bacteria (to destroy their virulence) and noticed that mice injected with the heat-killed bacteria and a living, non-virulent strain would die of infection.
This process is known as transformation. It was discovered after Griffith heat treated bacteria (to destroy their virulence) and noticed that mice injected with the heat-killed bacteria and a living, non-virulent strain would die of infection.
Compare your answer with the correct one above