Genetics : Laboratory Procedures and Important Historical Experiments

Study concepts, example questions & explanations for Genetics

varsity tutors app store varsity tutors android store

Example Questions

← Previous 1

Example Question #1 : Laboratory Procedures And Important Historical Experiments

In order to amplify the following DNA sequence using PCR, what is an acceptable pair of oligonucleotide primers? (only the sense strand is shown)

ATGATCAGGCTAAATGCTAGTTTACCGGATGAGCAATGACGCGTACCATATAGGCATATCCGATGCCATGATGGCCTACGGATCA

Possible Answers:

Forward: 5' ATGATCAGGCTAAATGCTA 3'

Reverse: 5' ACTAGGCATCCGGTAGTACC 3'

Forward: 5' ATGATCAGGCTAAATGCTA 3'

Reverse: 5' CCATGATGGCCTACGGATCA 3'

Forward: 5' ATGATCAGG 3'

Reverse: 5' ACTAGGCATC 3'

Forward: 5' ATGATCAGGCTAAATGCTA 3'

Reverse: 5' TGATCCGTAGGCCATCATGG 3'

Forward: 5' ATGATCAGG 3'

Reverse: 5' TGATCCGTA 3'

Correct answer:

Forward: 5' ATGATCAGGCTAAATGCTA 3'

Reverse: 5' TGATCCGTAGGCCATCATGG 3'

Explanation:

There are two primary factors that influence the quality of a polymerase chain reaction (PCR) primer. The first is length. The primer should ideally be roughly 18-30 bases in length; this qualification can be used to rule out two of the possible given answer options. The second factor is the melting point of the primer. An ideal oligonucleutide sequence will have a relatively high cytosine/guanine content. These particular bases form three hydrogen bonds in the DNA molecule, while adenine and thymine form only two. Cytosine and guanine interactions thus require more energy to break, and raise hte melting point of the sample. The process of PCR requires heating the sample at certain points, which can become a problem for primers with high adenine/thymine content.

Our ideal answer will be a longer sequence (18 bases) with a high percentage of cytosine and guanine residues.

Example Question #2 : Laboratory Procedures And Important Historical Experiments

Which of the following scientists first discovered the concepts behind dominance, segregation, and independent assortment?

Possible Answers:

Louis Pasteur

Rosalind Franklin

Charles Darwin

Gregor Mendel

Correct answer:

Gregor Mendel

Explanation:

It was Gregor Mendel who did studies on pea plants to first described the concepts behind genetic inheritance. By breeding pea plants with different visible phenotypes and observing the phenotypes of the offspring produced, he was the first scientist to provide rules for heredity (now known as Mendelian inheritance). 

Example Question #3 : Laboratory Procedures And Important Historical Experiments

What is the name of the laboratory procedure by which a small amount of DNA can be made into many more copies through the use of DNA polymerases and heat cycling?

Possible Answers:

Reverse transcription

Molecular cloning

Western blotting

Polymerase chain reaction

Southern blotting

Correct answer:

Polymerase chain reaction

Explanation:

Polymerase chain reaction (PCR) is a method by which a specific sequence of DNA can be copied and replicated many times over in a test tube, which has been of enormous importance to the field of molecular biology. The other techniques listed all are important in molecular biology as well, but are typically for detection or other manipulations, not replication. 

Example Question #4 : Laboratory Procedures And Important Historical Experiments

What is the name of the method that allowed Watson and Crick to propose the double-helix structure of DNA?

Possible Answers:

Genetic recombination

X-ray crystallography

Ethyl methanesulfonate mutagenesis

Polymerase chain reaction

Pulse-chase analysis

Correct answer:

X-ray crystallography

Explanation:

Watson and Crick crystallized DNA to be able to visualize the structure, and it was this finding that led them to propose the double helix. Fun fact: Rosalind Franklin's work was essential to this finding as she was the expert in x-ray crystallography, but Watson and Crick are traditionally given all the credit. 

Example Question #5 : Laboratory Procedures And Important Historical Experiments

Choose the correct answer:

In 1928, microbiologist Frederick Griffith demonstrated that bacteria can take up foreign DNA from the environment by a process known as __________.

Possible Answers:

transfection

transformation

translocation

heat shock

Correct answer:

transformation

Explanation:

This process is known as transformation. It was discovered after Griffith heat treated bacteria (to destroy their virulence) and noticed that mice injected with the heat-killed bacteria and a living, non-virulent strain would die of infection.

Example Question #6 : Laboratory Procedures And Important Historical Experiments

Chose the correct answer:

American geneticist Thomas Hunt Morgan is best known for __________.

Possible Answers:

being the first person to isolate hereditary material

being the first person to definitively link the inheritance of a specific trait with a particular chromosome

explaining semi-conservative DNA replication

explaining the relationship between DNA and protein production

Correct answer:

being the first person to definitively link the inheritance of a specific trait with a particular chromosome

Explanation:

In 1910, Thomas Hunt Morgan performed a test cross between white-eyed male Drosophila and homozygous red-eyed females to test the frequency of white eyes in the subsequent generations. The F1 generation all had red eyes, but when Morgan crossed the F1 generation, he noticed a 3:1 ratio of red to white eyes in the F2 generation. In all of his experimements, the white-eyed F2 flies were always male. Subsequent experiments supported the hypothesis that the white-eye trait was sex-linked (in this case, to the X chromosome).

Example Question #7 : Laboratory Procedures And Important Historical Experiments

Choose the correct answer:

The idea that protein could be hereditary material was proved false in 1952 by which two scientists?

Possible Answers:

James Watson and Francis Crick

Oswald Avery and Frederick Griffith

Matthew Meselson and Franklin Stahl

Alfred Hershey and Martha Chase

Correct answer:

Alfred Hershey and Martha Chase

Explanation:

Hershey and Chase used radioisotopes to trace the DNA of a T2 phage (a virus that infects E. coli). Proteins contain sulfur; DNA does not. DNA contains phosphate; proteins do not. Using radioactive forms of sulfur and phosphate, they were able to selectively incorporate these isotopes into either the DNA or protein of a T2 phage and then physically separated the infected and uninfected bacteria. They found that the sulfur was not incorporated, while a portion of the phosphate entered the cells and could be recovered in the next generation. From these results, they were able to conclude that protein was not a hereditary material.

Example Question #8 : Laboratory Procedures And Important Historical Experiments

Choose the correct answer:

Nucleic acid (at the time referred to as "nuclein") was first discovered by whom in 1869? 

Possible Answers:

Charles Darwin

James Watson

Friedrich Miescher

Rosalind Franklin

Correct answer:

Friedrich Miescher

Explanation:

Miescher, a Swiss chemist, first identified "nuclein" in the nuclei of white blood cells. He noted that the substance contained higher levels of phosphorus than other proteins and was resistant to proteolysis. This discovery was not widely appreciated for over 50 years.

Example Question #9 : Laboratory Procedures And Important Historical Experiments

Choose the correct answer:

Which of the following is a technique used to measure expression levels of large numbers of genes at the same time by taking advantage of hybridization between two DNA strands?

Possible Answers:

DNA microarray

PCR

northern blot

western blot

Correct answer:

DNA microarray

Explanation:

DNA microarray allows investigators to analyze gene expression on a large scale. A Northern blot only permits analysis of the expression of one (or several) genes at a time. PCR is a method of amplifying DNA and a Western blot allows for analysis of proteins.

Example Question #10 : Laboratory Procedures And Important Historical Experiments

Choose the correct answer:

In the mid-1950s, there were three proposed models for DNA replication: semiconservative, conservative, and dispersive. Which of the following best describes the dispersive replication model?

Possible Answers:

The whole original DNA double helix is a template for a new double helix. Each cell division results in two cells: one with a new double helix and one with the original double helix.

The original DNA double helix is fragmented, with each fragment becoming a template for a new DNA fragment. Each cell division results in two cells with various amounts of old and new DNA.

The original DNA helix breaks into individual nucleotides which reassemble in daughter cells after cell division.

Two DNA strands separate and each serves as a template for one new DNA strand. Each cell division results in a cell with DNA that is half original, half newly-synthesized.

Correct answer:

The original DNA double helix is fragmented, with each fragment becoming a template for a new DNA fragment. Each cell division results in two cells with various amounts of old and new DNA.

Explanation:

The dispersive model (now recognized to be incorrect), proposed that every occurrence of DNA replication would create DNA hybrids (from fragments of the the original double helix) that are one part original and one part new DNA. Each additional round would produce double helices with greater and greater quantities of DNA.

← Previous 1
Learning Tools by Varsity Tutors

Incompatible Browser

Please upgrade or download one of the following browsers to use Instant Tutoring: